shRNA Adeno-associated Virus Serotype 2, p7SK-(PRELID2-shRNA-Seq3)(CAT#: AAV-SI1300WQ)

This product is a PRELID2-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of PRELID2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert PRELID2-shRNA-Seq3
Related Target/Protein PRELID2
Region 3UTR
TargetSeq CCAATGCGTTATGATGATTAA
NCBI RefSeq NM_138492
Titer >1*10^10 GC/mL
Related Diseases Chronic Hepatitis B infection
Target Gene
Gene ID 153768
Uniprot ID Q8N945

Related Products