shRNA Adeno-associated Virus Serotype 2, p7SK-(Prlhr-shRNA-Seq1)(CAT#: AAV-SI4025WQ)
This product is a Prlhr-shRNA encoding AAV, which is based on AAV-2 serotype. The Prlhr gene is a 7-transmembrane domain receptor for prolactin-releasing hormone that is highly expressed in anterior pituitary. The expression of Prlhr-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | Prlhr-shRNA-Seq1 |
| Related Target/Protein | Prlhr |
| Region | 3UTR |
| TargetSeq | GATCTTATTCCCAGCACCAAA |
| NCBI RefSeq | NM_201615 |
| Alternative Names | GR3; GPR10; PrRPR |
| Titer | >1*10^10 GC/mL |
