shRNA Adeno-associated Virus Serotype 2, p7SK-(PRRC2A-shRNA-Seq1)(CAT#: AAV-SI1395WQ)
This product is a PRRC2A-shRNA encoding AAV, which is based on AAV-2 serotype. The PRRC2A gene has microsatellite repeats which are associated with the age-at-onset of insulin-dependent diabetes mellitus (IDDM) and possibly thought to be involved with the inflammatory process of pancreatic beta-cell destruction during the development of IDDM. The expression of PRRC2A-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | PRRC2A-shRNA-Seq1 |
| Related Target/Protein | PRRC2A |
| Region | CDS |
| TargetSeq | CCTCGCTCAACCTGTTTGATA |
| NCBI RefSeq | NM_004638 |
| Alternative Names | G2; BAT2; D6S51; D6S51E |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Insulin-dependent diabetes mellitus (IDDM) |