shRNA Adeno-associated Virus Serotype 2, p7SK-(RSBN1-shRNA-Seq2)(CAT#: AAV-SI1076WQ)

This product is a RSBN1-shRNA encoding AAV, which is based on AAV-2 serotype. The RSBN1 gene specifically demethylates dimethylated 'Lys-20' of histone H4 (H4K20me2), thereby modulating chromosome architecture. The expression of RSBN1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert RSBN1-shRNA-Seq2
Related Target/Protein RSBN1
Region CDS
TargetSeq CACTCAGGTCAACAGGACATA
NCBI RefSeq NM_018364
Alternative Names KDM9; ROSBIN
Titer >1*10^10 GC/mL
Related Diseases Breast cancer
Target Gene
Gene ID 54665
Uniprot ID Q80T69

Related Products