shRNA Adeno-associated Virus Serotype 2, p7SK-(SAMD13-shRNA-Seq1)(CAT#: AAV-SI1451WQ)

This product is a SAMD13-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of SAMD13-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert SAMD13-shRNA-Seq1
Related Target/Protein SAMD13
Region CDS
TargetSeq CTCTGCAGACAAAGCATTTAA
NCBI RefSeq NM_001010971
Alternative Names HSD-41; HSD-42
Titer >1*10^10 GC/mL
Related Diseases Breast Cancer
Target Gene
Gene ID 148418
Uniprot ID Q5VXD3

Related Products