shRNA Adeno-associated Virus Serotype 2, p7SK-(SESN3-shRNA-Seq1)(CAT#: AAV-SI3413WQ)
This product is a SESN3-shRNA encoding AAV, which is based on AAV-2 serotype. The SESN3 gene encodes a member of the sestrin family of stress-induced proteins and plays a role in lipid storage in obesity. The expression of SESN3-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | SESN3-shRNA-Seq1 |
| Related Target/Protein | SESN3 |
| Region | CDS |
| TargetSeq | CGTACTAACTTTCTTGTGGAA |
| NCBI RefSeq | NM_144665 |
| Alternative Names | SEST3 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Obesity |