shRNA Adeno-associated Virus Serotype 2, p7SK-(SFTA2-shRNA-Seq1)(CAT#: AAV-SI1079WQ)

This product is a SFTA2-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by SFTA2 is a novel secretory peptide highly expressed in the lung. The expression of SFTA2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert SFTA2-shRNA-Seq1
Related Target/Protein SFTA2
Region CDS
TargetSeq CGGGTATGACTTTGCAACTGA
NCBI RefSeq NM_205854
Alternative Names SP-G; SFTPG; UNQ541; GSGL541
Titer >1*10^10 GC/mL
Related Diseases Lung cancer
Target Gene
Gene ID 389376
Uniprot ID Q6UW10

Related Products