shRNA Adeno-associated Virus Serotype 2, p7SK-(SFTA2-shRNA-Seq1)(CAT#: AAV-SI1079WQ)
This product is a SFTA2-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by SFTA2 is a novel secretory peptide highly expressed in the lung. The expression of SFTA2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | SFTA2-shRNA-Seq1 |
Related Target/Protein | SFTA2 |
Region | CDS |
TargetSeq | CGGGTATGACTTTGCAACTGA |
NCBI RefSeq | NM_205854 |
Alternative Names | SP-G; SFTPG; UNQ541; GSGL541 |
Titer | >1*10^10 GC/mL |
Related Diseases | Lung cancer |