shRNA Adeno-associated Virus Serotype 2, p7SK-(SH3BP5-shRNA-Seq1)(CAT#: AAV-SI1438WQ)

This product is a SH3BP5-shRNA encoding AAV, which is based on AAV-2 serotype. The SH3BP5 gene functions as guanine nucleotide exchange factor (GEF) with specificity for RAB11A and RAB25. The expression of SH3BP5-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert SH3BP5-shRNA-Seq1
Related Target/Protein SH3BP5
Region CDS
TargetSeq CCTTTGAAGATGACAGCTGTA
NCBI RefSeq NM_004844
Alternative Names SAB; SH3BP-5
Titer >1*10^10 GC/mL
Related Diseases Acute Liver Failure
Target Gene
Gene ID 9467
Uniprot ID O60239

Related Products