shRNA Adeno-associated Virus Serotype 2, p7SK-(SH3BP5-shRNA-Seq2)(CAT#: AAV-SI1439WQ)
This product is a SH3BP5-shRNA encoding AAV, which is based on AAV-2 serotype. The SH3BP5 gene functions as guanine nucleotide exchange factor (GEF) with specificity for RAB11A and RAB25. The expression of SH3BP5-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | SH3BP5-shRNA-Seq2 |
| Related Target/Protein | SH3BP5 |
| Region | CDS |
| TargetSeq | CAAAGCTGTGGAAGACTCCAA |
| NCBI RefSeq | NM_004844 |
| Alternative Names | SAB; SH3BP-5 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Acute Liver Failure |