shRNA Adeno-associated Virus Serotype 2, p7SK-(TCTN3-shRNA-Seq1)(CAT#: AAV-SI3943WQ)

This product is a TCTN3-shRNA encoding AAV, which is based on AAV-2 serotype. The TCTN3 gene encodes a member of the tectonic gene family which functions in Hedgehog signal transduction and development of the neural tube. Mutations in this gene have been associated with Orofaciodigital Syndrome IV and Joubert Syndrom 18. The expression of TCTN3-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert TCTN3-shRNA-Seq1
Related Target/Protein TCTN3
Region CDS
TargetSeq CATACCAGTTTCCCTGGAGAT
NCBI RefSeq NM_015631
Alternative Names OFD4; TECT3; JBTS18; C10orf61
Titer >1*10^10 GC/mL
Related Diseases Orofaciodigital Syndrome IV and Joubert Syndrom 18
Target Gene
Gene ID 26123
Uniprot ID Q6NUS6

Related Products