shRNA Adeno-associated Virus Serotype 2, p7SK-(Tha1-shRNA-Seq1)(CAT#: AAV-SI3939WQ)
This product is a Tha1-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by Tha1 gene has L-allo-threonine aldolase activity. The expression of Tha1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | Tha1-shRNA-Seq1 |
| Related Target/Protein | Tha1 |
| Region | 3UTR |
| TargetSeq | CTGGAGGATGGTGACATCATT |
| NCBI RefSeq | NM_027919 |
| Alternative Names | GLY1; 1300017K07Rik |
| Titer | >1*10^10 GC/mL |
