shRNA Adeno-associated Virus Serotype 2, p7SK-(Tmem146-shRNA-Seq1)(CAT#: AAV-SI3676WQ)

This product is a Tmem146-shRNA encoding AAV, which is based on AAV-2 serotype. The Tmem146 gene encodes auxiliary component of the CatSper complex, a complex involved in sperm cell hyperactivation. The expression of Tmem146-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Tmem146-shRNA-Seq1
Related Target/Protein Tmem146
Region CDS
TargetSeq CCAGGATGACCTGATAGTATT
NCBI RefSeq XM_001052081
Alternative Names CATSPERD
Titer >1*10^10 GC/mL
Related Diseases Infertility
Target Gene
Gene ID 257062
Uniprot ID Q86XM0

Related Products