shRNA Adeno-associated Virus Serotype 2, p7SK-(TMEM177-shRNA-Seq2)(CAT#: AAV-SI3505WQ)
This product is a TMEM177-shRNA encoding AAV, which is based on AAV-2 serotype. The preotien encoded by TMEM177 gene plays a role in the early steps of cytochrome c oxidase subunit II (MT-CO2/COX2) maturation. The expression of TMEM177-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | TMEM177-shRNA-Seq2 |
| Related Target/Protein | TMEM177 |
| Region | 3UTR |
| TargetSeq | CTATGAATCTGAGCCTTTGTT |
| NCBI RefSeq | NM_030577 |
| Titer | >1*10^10 GC/mL |
