shRNA Adeno-associated Virus Serotype 2, p7SK-(Tmem26-shRNA-Seq1)(CAT#: AAV-SI3912WQ)

This product is a Tmem26-shRNA encoding AAV, which is based on AAV-2 serotype. The Tmem26 gene encodes a protein containing multiple transmembrane helices. It is a selective surface protein marker of brite/beige adipocytes, which may coexist with classical brown adipocytes in brown adipose tissue. The expression of Tmem26-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Tmem26-shRNA-Seq1
Related Target/Protein Tmem26
Region CDS
TargetSeq CAGAGGCTTTGTCGACAATTT
NCBI RefSeq NM_177794
Titer >1*10^10 GC/mL
Target Gene
Gene ID 219623
Uniprot ID Q6ZUK4

Related Products