shRNA Adeno-associated Virus Serotype 2, p7SK-(TMEM60-shRNA-Seq1)(CAT#: AAV-SI1233WQ)

This product is a TMEM60-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of TMEM60-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert TMEM60-shRNA-Seq1
Related Target/Protein TMEM60
Region CDS
TargetSeq GCTTTAACAGAACTCGGATAT
NCBI RefSeq NM_032936
Alternative Names DC32; C7orf35
Titer >1*10^10 GC/mL
Related Diseases Kidney function and chronic kidney disease
Target Gene
Gene ID 85025
Uniprot ID Q9H2L4

Related Products