shRNA Adeno-associated Virus Serotype 2, p7SK-(TTC18-shRNA-Seq2)(CAT#: AAV-SI1115WQ)
This product is a TTC18-shRNA encoding AAV, which is based on AAV-2 serotype. The TTC18 gene ecoded protein is a novel axoneme-binding protein that localizes at the base of the outer dynein arm and regulates ciliary motility. The expression of TTC18-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | TTC18-shRNA-Seq2 |
| Related Target/Protein | TTC18 |
| Region | CDS |
| TargetSeq | CCTCCTAACTGAAGACAACAT |
| NCBI RefSeq | NM_145170 |
| Alternative Names | CFAP70 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Outer dynein arm (ODA) |