shRNA Adeno-associated Virus Serotype 2, p7SK-(Vmn1r9-shRNA-Seq3)(CAT#: AAV-SI3764WQ)
This product is a Vmn1r9-shRNA encoding AAV, which is based on AAV-2 serotype. The Vmn1r9 gene has pheromone binding and pheromone receptor activity. The expression of Vmn1r9-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | Vmn1r9-shRNA-Seq3 |
| Related Target/Protein | Vmn1r9 |
| Region | CDS |
| TargetSeq | CAACTGACCTTTGTTCACATA |
| NCBI RefSeq | NM_134185 |
| Alternative Names | V1rc30 |
| Titer | >1*10^10 GC/mL |
