shRNA Adeno-associated Virus Serotype 2, p7SK-(ZDHHC19-shRNA-Seq1)(CAT#: AAV-SI1080WQ)
This product is a ZDHHC19-shRNA encoding AAV, which is based on AAV-2 serotype. ZDHHC19 is a Protein Coding gene. Gene Ontology (GO) annotations related to this gene include protein-cysteine S-palmitoyltransferase activity. The expression of ZDHHC19-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | ZDHHC19-shRNA-Seq1 |
| Related Target/Protein | ZDHHC19 |
| Region | CDS |
| TargetSeq | GCCAGCAACTGGTATTTAACA |
| NCBI RefSeq | NM_144637 |
| Alternative Names | DHHC19 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Liver cancer |