shRNA Adeno-associated Virus Serotype 2, p7SK-(Zfp414-shRNA-Seq1)(CAT#: AAV-SI3931WQ)
This product is a Zfp414-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by Zfp414 gene may be involved in transcriptional regulation. The expression of Zfp414-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | Zfp414-shRNA-Seq1 |
| Related Target/Protein | Zfp414 |
| Region | CDS |
| TargetSeq | GTTCGTGATCTAGCACAGCAT |
| NCBI RefSeq | NM_026712 |
| Alternative Names | Znf414; 0610030H11Rik |
| Titer | >1*10^10 GC/mL |