shRNA Adeno-associated Virus Serotype 2, p7SK-(Zpbp-shRNA-Seq5)(CAT#: AAV-SI3660WQ)
This product is a Zpbp-shRNA encoding AAV, which is based on AAV-2 serotype. ZPBP is one of several proteins that are thought to participate in secondary binding between acrosome-reacted sperm and the egg-specific extracellular matrix, the zona pellucida. The expression of Zpbp-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | Zpbp-shRNA-Seq5 |
| Related Target/Protein | Zpbp |
| Region | CDS |
| TargetSeq | GTGTAACCCAACGACTGAGAA |
| NCBI RefSeq | NM_015785 |
| Alternative Names | ZPBP1 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Infertility |