shRNA Adeno-associated Virus Serotype 2, pH1-(2810403A07Rik-shRNA-Seq1)(CAT#: AAV-SI3189WQ)

This product is a 2810403A07Rik-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of 2810403A07Rik-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert 2810403A07Rik-shRNA-Seq1
Related Target/Protein 2810403A07Rik
Region 3UTR
TargetSeq GCATTCTTTCTTTACTGGGAT
NCBI RefSeq NM_028814
Alternative Names Blom7; AI256352; AI451678; Kiaa0907; Khdc4; A430106P18Rik
Titer >1*10^10 GC/mL
Target Gene
Gene ID 74200
Uniprot ID A0A0G2JEG2

Related Products