shRNA Adeno-associated Virus Serotype 2, pH1-(4932416K20Rik-shRNA-Seq1)(CAT#: AAV-SI3172WQ)

This product is a 4932416K20Rik-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of 4932416K20Rik-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert 4932416K20Rik-shRNA-Seq1
Related Target/Protein 4932416K20Rik
Region CDS
TargetSeq CAAACGCAACCGTGTCCATTA
NCBI RefSeq NM_001002775
Titer >1*10^10 GC/mL
Target Gene
Gene ID 442809
Uniprot ID Q8CDH3

Related Products