shRNA Adeno-associated Virus Serotype 2, pH1-(9330180L21Rik-shRNA-Seq1)(CAT#: AAV-SI3145WQ)
This product is a 9330180L21Rik-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by 9330180L21Rik gene is part of various corepressor complexes mediates the recruitment of corepressor complexes to target genes, followed by chromatin compaction and repression of transcription. The expression of 9330180L21Rik-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | 9330180L21Rik-shRNA-Seq1 |
| Related Target/Protein | 9330180L21Rik |
| Region | CDS |
| TargetSeq | CTACCTATTGACCTGGAGTTT |
| NCBI RefSeq | NM_175254 |
| Alternative Names | Smr; Sfmbt; AA536974; 4930442N21Rik; Sfmbt1 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Infertility |