shRNA Adeno-associated Virus Serotype 2, pH1-(Adm2-shRNA-Seq1)(CAT#: AAV-SI2811WQ)
This product is a Adm2-shRNA encoding AAV, which is based on AAV-2 serotype. The Adm2 gene encodes a member of the calcitonin gene-related peptide (CGRP)/calcitonin family of hormones that play a role in the regulation of cardiovascular homeostasis. The expression of Adm2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | Adm2-shRNA-Seq1 |
Related Target/Protein | Adm2 |
Region | 3UTR |
TargetSeq | CTATGAGGATATGTGGATCTA |
NCBI RefSeq | NM_182928 |
Alternative Names | AM2; dJ579N16.4 |
Titer | >1*10^10 GC/mL |
Related Diseases | Gastrointestinal and cardiovascular disease |