shRNA Adeno-associated Virus Serotype 2, pH1-(Agpat4-shRNA-Seq4)(CAT#: AAV-SI2620WQ)
This product is a Agpat4-shRNA encoding AAV, which is based on AAV-2 serotype. The Agpat4 gene encodes a member of the 1-acylglycerol-3-phosphate O-acyltransferase family and this integral membrane protein converts lysophosphatidic acid to phosphatidic acid. The expression of Agpat4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | Agpat4-shRNA-Seq4 |
| Related Target/Protein | Agpat4 |
| Region | CDS |
| TargetSeq | GCTGGGAGTCTTAAATGGAAA |
| NCBI RefSeq | NM_026644 |
| Alternative Names | 1-AGPAT4; dJ473J16.2; LPAAT-delta |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Cancer |
