shRNA Adeno-associated Virus Serotype 2, pH1-(C20orf24-shRNA-Seq1)(CAT#: AAV-SI0756WQ)

This product is a C20orf24-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of C20orf24-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert C20orf24-shRNA-Seq1
Related Target/Protein C20orf24
Region 3UTR
TargetSeq CCATCAAGTAACAGCTATTAT
NCBI RefSeq NM_018840
Alternative Names RIP5; PNAS-11; RAB5IF
Titer >1*10^10 GC/mL
Target Gene
Gene ID 55969
Uniprot ID Q9BUV8

Related Products