shRNA Adeno-associated Virus Serotype 2, pH1-(C9orf23-shRNA-Seq1)(CAT#: AAV-SI0818WQ)
This product is a C9orf23-shRNA encoding AAV, which is based on AAV-2 serotype. The C9orf23 gene encodes a protein that appears to belong to a family of evolutionarily related proteins (DUF78), that may share one or more domains in common. The expression of C9orf23-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | C9orf23-shRNA-Seq1 |
| Related Target/Protein | C9orf23 |
| Region | CDS |
| TargetSeq | CCAATGAGTGTGGTTACCAAC |
| NCBI RefSeq | NM_148178 |
| Alternative Names | RPP25L; bA296L22.5 |
| Titer | >1*10^10 GC/mL |
