shRNA Adeno-associated Virus Serotype 2, pH1-(CABIN1-shRNA-Seq4)(CAT#: AAV-SI0731WQ)
This product is a CABIN1-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by CABIN1 gene binds specifically to the activated form of calcineurin and inhibits calcineurin-mediated signal transduction. The expression of CABIN1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | CABIN1-shRNA-Seq4 |
| Related Target/Protein | CABIN1 |
| Region | CDS |
| TargetSeq | CCGCCACAACTATTATCACCT |
| NCBI RefSeq | NM_012295 |
| Alternative Names | CAIN; PPP3IN; KB-318B8.7 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Glomerular podocyte injury |