shRNA Adeno-associated Virus Serotype 2, pH1-(CCDC67-shRNA-Seq1)(CAT#: AAV-SI0695WQ)

This product is a CCDC67-shRNA encoding AAV, which is based on AAV-2 serotype. The CCDC67 gene is key structural component of the deuterosome, a structure that promotes de novo centriole amplification in multiciliated cells. The expression of CCDC67-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert CCDC67-shRNA-Seq1
Related Target/Protein CCDC67
Region CDS
TargetSeq CGTTTGATATGTGACCCAGAT
NCBI RefSeq NM_181645
Alternative Names DEUP1
Titer >1*10^10 GC/mL
Related Diseases Papillary thyroid carcinoma, gastric cancer
Target Gene
Gene ID 159989
Uniprot ID Q05D60

Related Products