shRNA Adeno-associated Virus Serotype 2, pH1-(CEP76-shRNA-Seq1)(CAT#: AAV-SI0738WQ)

This product is a CEP76-shRNA encoding AAV, which is based on AAV-2 serotype. The CEP76 gene encodes a centrosomal protein which regulates centriole amplification by limiting centriole duplication to once per cell cycle. The expression of CEP76-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert CEP76-shRNA-Seq1
Related Target/Protein CEP76
Region CDS
TargetSeq CACATTTAAAGGGTTCCCAAT
NCBI RefSeq NM_024899
Alternative Names C18orf9; HsT1705
Titer >1*10^10 GC/mL
Related Diseases Centriole reduplication
Target Gene
Gene ID 79959
Uniprot ID Q8TAP6

Related Products