shRNA Adeno-associated Virus Serotype 2, pH1-(CEP76-shRNA-Seq1)(CAT#: AAV-SI0738WQ)
This product is a CEP76-shRNA encoding AAV, which is based on AAV-2 serotype. The CEP76 gene encodes a centrosomal protein which regulates centriole amplification by limiting centriole duplication to once per cell cycle. The expression of CEP76-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | CEP76-shRNA-Seq1 |
Related Target/Protein | CEP76 |
Region | CDS |
TargetSeq | CACATTTAAAGGGTTCCCAAT |
NCBI RefSeq | NM_024899 |
Alternative Names | C18orf9; HsT1705 |
Titer | >1*10^10 GC/mL |
Related Diseases | Centriole reduplication |