shRNA Adeno-associated Virus Serotype 2, pH1-(DDX3X-shRNA-Seq1)(CAT#: AAV-SI0502WQ)
This product is a DDX3X-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by DDX3X has ATP-dependent RNA helicase activity and display a high level of RNA-independent ATPase activity. Misregulation of this gene has been implicated in tumorigenesis and alternative splicing results in multiple transcript variants. The expression of DDX3X-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | DDX3X-shRNA-Seq1 |
| Related Target/Protein | DDX3X |
| Region | 3UTR |
| TargetSeq | CCCTGCCAAACAAGCTAATAT |
| NCBI RefSeq | NM_001356 |
| Alternative Names | DBX; DDX3; HLP2; DDX14; CAP-Rf; MRX102 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | X-linked recessive inheritance |