shRNA Adeno-associated Virus Serotype 2, pH1-(DEPDC1-shRNA-Seq1)(CAT#: AAV-SI0565WQ)
This product is a DEPDC1-shRNA encoding AAV, which is based on AAV-2 serotype. The DEPDC1 gene may be involved in transcriptional regulation as a transcriptional corepressor. The expression of DEPDC1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | DEPDC1-shRNA-Seq1 |
| Related Target/Protein | DEPDC1 |
| Region | CDS |
| TargetSeq | GAGATGGACTATTTGCTCCTT |
| NCBI RefSeq | NM_017779 |
| Alternative Names | DEP.8; SDP35; DEPDC1A; DEPDC1-V2 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Bladder cancer |