shRNA Adeno-associated Virus Serotype 2, pH1-(DKFZp434P055-shRNA-Seq1)(CAT#: AAV-SI0828WQ)

Datasheet

This product is a DKFZp434P055-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of DKFZp434P055-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert DKFZp434P055-shRNA-Seq1
Related Target/Protein DKFZp434P055
Region CDS
TargetSeq CTGAACGCATAGAAGCTCTAA
NCBI RefSeq NM_173466
Titer >1*10^10 GC/mL

Related Products

shRNA Adeno-associated Virus Serotype 2, pU6-(Gm16776-shRNA-Seq6) (CAT#:AAV-SI2088WQ) AAV6-U6 (MCS)-CAG (EGFP) (CAT#:AAV-GTK0209WQ) AAV PHP.B-COL2A1p (MCS-EGFP-3Flag)-SV40 PolyA (CAT#:AAV-GTK0651WQ) Recombinant adeno-associated virus type 9, pU6-(Mouse PEDF), Overexpression (CAT#:AAV-GTOH1592WQ) shRNA Adeno-associated Virus Serotype 2, pH1-(6030498E09Rik-shRNA-Seq1) (CAT#:AAV-SI2757WQ) shRNA Adeno-associated Virus Serotype 2, pU6-(Olfr1477-shRNA-Seq1) (CAT#:AAV-SI2269WQ) shRNA Adeno-associated Virus Serotype 2, pU6-(TREH-shRNA-Seq2) (CAT#:AAV-SI0370WQ) shRNA Adeno-associated Virus Serotype 2, p7SK-(COG6-shRNA-Seq2) (CAT#:AAV-SI3990WQ)