shRNA Adeno-associated Virus Serotype 2, pH1-(Erc1-shRNA-Seq1)(CAT#: AAV-SI3186WQ)
This product is a Erc1-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by Erc1 gene is a member of a family of RIM-binding proteins. RIMs are active zone proteins that regulate neurotransmitter release. The expression of Erc1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | Erc1-shRNA-Seq1 |
| Related Target/Protein | Erc1 |
| Region | CDS |
| TargetSeq | GCAGATAAAGAACGGACGATT |
| NCBI RefSeq | NM_053204 |
| Alternative Names | ELKS; Cast2; ERC-1; RAB6IP2 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Thyroid papillary carcinoma |
