shRNA Adeno-associated Virus Serotype 2, pH1-(Fam166a-shRNA-Seq1)(CAT#: AAV-SI2582WQ)

This product is a Fam166a-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of Fam166a-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Fam166a-shRNA-Seq1
Related Target/Protein Fam166a
Region CDS
TargetSeq CCTTTCTACATGGGCTTTATC
NCBI RefSeq NM_026624
Alternative Names HSD46
Titer >1*10^10 GC/mL
Target Gene
Gene ID 401565
Uniprot ID Q6J272

Related Products