shRNA Adeno-associated Virus Serotype 2, pH1-(FAM70A-shRNA-Seq1)(CAT#: AAV-SI0652WQ)
This product is a FAM70A-shRNA encoding AAV, which is based on AAV-2 serotype. TMEM255A is often referred to as family with sequence similarity 70, member A (FAM70A). The TMEM255A protein is transmembrane and is predicted to be located the nuclear envelope of eukaryote organisms. The expression of FAM70A-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | FAM70A-shRNA-Seq1 |
Related Target/Protein | FAM70A |
Region | CDS |
TargetSeq | CCATCTATGTCACCGTGACTT |
NCBI RefSeq | NM_017938 |
Alternative Names | Tmem255a; 4933417N17; 6430550H21Rik |
Titer | >1*10^10 GC/mL |
Related Diseases | Glioblastoma multiforme |