shRNA Adeno-associated Virus Serotype 2, pH1-(Gaa-shRNA-Seq1)(CAT#: AAV-SI3087WQ)
This product is a Gaa-shRNA encoding AAV, which is based on AAV-2 serotype. The Gaa gene encodes lysosomal alpha-glucosidase, which is essential for the degradation of glycogen to glucose in lysosomes. The expression of Gaa-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | Gaa-shRNA-Seq1 |
| Related Target/Protein | Gaa |
| Region | 3UTR |
| TargetSeq | CCCTGAAGCTCTGTGTTCTTA |
| NCBI RefSeq | NM_008064 |
| Alternative Names | LYAG |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Pompe's disease |
