shRNA Adeno-associated Virus Serotype 2, pH1-(HEATR2-shRNA-Seq1)(CAT#: AAV-SI0886WQ)

This product is a HEATR2-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by HEATR2 gene is essential for the preassembly or stability of axonemal dynein arms, and is found only in organisms with motile cilia and flagella. The expression of HEATR2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert HEATR2-shRNA-Seq1
Related Target/Protein HEATR2
Region CDS
TargetSeq CGACTGATCTCATGCCGTATT
NCBI RefSeq NM_017802
Alternative Names CILD18; DNAAF5
Titer >1*10^10 GC/mL
Related Diseases Primary ciliary dyskinesia-18
Target Gene
Gene ID 54919
Uniprot ID Q86Y56

Related Products