shRNA Adeno-associated Virus Serotype 2, pH1-(KHDRBS1-shRNA-Seq1)(CAT#: AAV-SI0545WQ)

This product is a KHDRBS1-shRNA encoding AAV, which is based on AAV-2 serotype.The KHDRBS1 encoded protein appears to have many functions and may be involved in a variety of cellular processes, including alternative splicing, cell cycle regulation, RNA 3'-end formation, tumorigenesis, and regulation of human immunodeficiency virus gene expression. The expression of KHDRBS1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert KHDRBS1-shRNA-Seq1
Related Target/Protein KHDRBS1
Region 3UTR
TargetSeq GTTCCCAAGTTAGTCAAGTAT
NCBI RefSeq NM_006559
Alternative Names p62; p68; Sam68
Titer >1*10^10 GC/mL
Related Diseases Primary ovarian insufficiency
Target Gene
Gene ID 10657
Uniprot ID Q07666

Related Products