shRNA Adeno-associated Virus Serotype 2, pH1-(KIAA1919-shRNA-Seq3)(CAT#: AAV-SI0674WQ)
This product is a KIAA1919-shRNA encoding AAV, which is based on AAV-2 serotype. The KIAA1919 gene may function as a sodium-dependent glucose transporter is potential channel for urea in the inner medulla of kidney. The expression of KIAA1919-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | KIAA1919-shRNA-Seq3 |
Related Target/Protein | KIAA1919 |
Region | CDS |
TargetSeq | CCTGCACTCAACCAATCATCT |
NCBI RefSeq | NM_153369 |
Alternative Names | NaGLT1; MFSD4B |
Titer | >1*10^10 GC/mL |
Related Diseases | Renal carcinoma |