shRNA Adeno-associated Virus Serotype 2, pH1-(LGI4-shRNA-Seq3)(CAT#: AAV-SI0594WQ)

This product is a LGI4-shRNA encoding AAV, which is based on AAV-2 serotype. The LGI4 gene encoded protein is component of Schwann cell signaling pathway(s) that controls axon segregation and myelin formation (By similarity). The expression of LGI4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert LGI4-shRNA-Seq3
Related Target/Protein LGI4
Region CDS
TargetSeq CCCAAGACTTTCAAGTGCAGA
NCBI RefSeq NM_139284
Alternative Names LGIL3; AMCNMY
Titer >1*10^10 GC/mL
Related Diseases Neurological diseases
Target Gene
Gene ID 163175
Uniprot ID Q8N135

Related Products