shRNA Adeno-associated Virus Serotype 2, pH1-(Lsm14a-shRNA-Seq5)(CAT#: AAV-SI2632WQ)
This product is a Lsm14a-shRNA encoding AAV, which is based on AAV-2 serotype. The Lsm14a gene encodes Sm-like proteins that are thought to form a stable heteromer present in tri-snRNP particles, which are important for pre-mRNA splicing. The expression of Lsm14a-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | Lsm14a-shRNA-Seq5 |
| Related Target/Protein | Lsm14a |
| Region | CDS |
| TargetSeq | CTCAGTTAGACCCTTTGAGAA |
| NCBI RefSeq | NM_025948 |
| Alternative Names | RAP55; FAM61A; RAP55A; C19orf13 |
| Titer | >1*10^10 GC/mL |
