shRNA Adeno-associated Virus Serotype 2, pH1-(Nkd1-shRNA-Seq1)(CAT#: AAV-SI3183WQ)
This product is a Nkd1-shRNA encoding AAV, which is based on AAV-2 serotype. The Nkd1 gene may activate a second Wnt signaling pathway that controls planar cell polarity. The expression of Nkd1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | Nkd1-shRNA-Seq1 |
| Related Target/Protein | Nkd1 |
| Region | CDS |
| TargetSeq | CACCATTACCACCACTTCTAT |
| NCBI RefSeq | NM_027280 |
| Alternative Names | Naked1 |
| Titer | >1*10^10 GC/mL |
