shRNA Adeno-associated Virus Serotype 2, pH1-(Ola1-shRNA-Seq2)(CAT#: AAV-SI2586WQ)
This product is a Ola1-shRNA encoding AAV, which is based on AAV-2 serotype. The Ola1 gene encodes a member of the GTPase protein family and interacts with breast cancer-associated gene 1 (BRCA1) and BRCA1-associated RING domain protein (BARD1), and is involved in centrosome regulation. The expression of Ola1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | Ola1-shRNA-Seq2 |
| Related Target/Protein | Ola1 |
| Region | CDS |
| TargetSeq | GCTGAAGTAATGAAGTATGAA |
| NCBI RefSeq | NM_025942 |
| Alternative Names | DOC45; GBP45; GTBP9; GTPBP9; PTD004 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Breast cancer |