shRNA Adeno-associated Virus Serotype 2, pH1-(Olfr912-shRNA-Seq1)(CAT#: AAV-SI3113WQ)

This product is a Olfr912-shRNA encoding AAV, which is based on AAV-2 serotype. The Olfr912 gene encodes a olfactory receptor protein that interacts with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The expression of Olfr912-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Olfr912-shRNA-Seq1
Related Target/Protein Olfr912
Region CDS
TargetSeq CTAAAGTCTGTTCCTATCTTA
NCBI RefSeq NM_146810
Alternative Names MOR165-4
Titer >1*10^10 GC/mL
Related Diseases Olfactory dysfunction
Target Gene
Gene ID 258806
Uniprot ID A0A1L1SSS5

Related Products