shRNA Adeno-associated Virus Serotype 2, pH1-(OR10G7-shRNA-Seq3)(CAT#: AAV-SI2402WQ)
This product is a OR10G7-shRNA encoding AAV, which is based on AAV-2 serotype. The OR10G7 gene encodes a olfactory receptor protein that interacts with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The expression of OR10G7-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | OR10G7-shRNA-Seq3 |
| Related Target/Protein | OR10G7 |
| Region | CDS |
| TargetSeq | GTCCTGATAGTGCTGTCCTAT |
| NCBI RefSeq | XM_372437 |
| Alternative Names | OR11-283 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Olfactory dysfunction |