shRNA Adeno-associated Virus Serotype 2, pH1-(PLEKHM1-shRNA-Seq1)(CAT#: AAV-SI0931WQ)
This product is a PLEKHM1-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by PLEKHM1 gene is essential for bone resorption, and may play a critical role in vesicular transport in the osteoclast. The expression of PLEKHM1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | PLEKHM1-shRNA-Seq1 |
| Related Target/Protein | PLEKHM1 |
| Region | 3UTR |
| TargetSeq | GCCAGTGCTTTCAGATGCATT |
| NCBI RefSeq | NM_014798 |
| Alternative Names | B2; AP162; OPTA3; OPTB6 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Autosomal recessive osteopetrosis type 6 (OPTB6) |