shRNA Adeno-associated Virus Serotype 2, pH1-(PRDM15-shRNA-Seq1)(CAT#: AAV-SI0713WQ)

This product is a PRDM15-shRNA encoding AAV, which is based on AAV-2 serotype. The PRDM15 gene plays a role as a molecular node in a transcriptional network regulating embryonic development and cell fate decision. The expression of PRDM15-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert PRDM15-shRNA-Seq1
Related Target/Protein PRDM15
Region CDS
TargetSeq CGAGATACCTTTGAACGTGAA
NCBI RefSeq NM_022115
Alternative Names PFM15; ZNF298; C21orf83
Titer >1*10^10 GC/mL
Related Diseases Pancreatic cancer
Target Gene
Gene ID 63977
Uniprot ID P57071

Related Products