shRNA Adeno-associated Virus Serotype 2, pH1-(Prr13-shRNA-Seq1)(CAT#: AAV-SI3163WQ)
This product is a Prr13-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by Prr13 gene may negatively regulate TSP1 expression at the level of transcription. The expression of Prr13-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | Prr13-shRNA-Seq1 |
| Related Target/Protein | Prr13 |
| Region | CDS |
| TargetSeq | GAAGTCGCACAAGCATCACAA |
| NCBI RefSeq | NM_025385 |
| Alternative Names | TXR1 |
| Titer | >1*10^10 GC/mL |
