shRNA Adeno-associated Virus Serotype 2, pH1-(Reep4-shRNA-Seq1)(CAT#: AAV-SI3177WQ)

This product is a Reep4-shRNA encoding AAV, which is based on AAV-2 serotype. The Reep4 gene probably acts by clearing the endoplasmic reticulum membrane from metaphase chromosomes. The expression of Reep4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Reep4-shRNA-Seq1
Related Target/Protein Reep4
Region 3UTR
TargetSeq GCACAGGGAGACATTCACTAT
NCBI RefSeq NM_180588
Alternative Names PP432; Yip2c; C8orf20
Titer >1*10^10 GC/mL
Target Gene
Gene ID 80346
Uniprot ID Q9H6H4

Related Products